ID: 940057571

View in Genome Browser
Species Human (GRCh38)
Location 2:149529006-149529028
Sequence AGCATGAGAGTTGTGTTCTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940057563_940057571 27 Left 940057563 2:149528956-149528978 CCTGTCTGAGCCCCTAGTGGGTT No data
Right 940057571 2:149529006-149529028 AGCATGAGAGTTGTGTTCTTTGG No data
940057564_940057571 17 Left 940057564 2:149528966-149528988 CCCCTAGTGGGTTAATTAGACCA No data
Right 940057571 2:149529006-149529028 AGCATGAGAGTTGTGTTCTTTGG No data
940057566_940057571 15 Left 940057566 2:149528968-149528990 CCTAGTGGGTTAATTAGACCATT No data
Right 940057571 2:149529006-149529028 AGCATGAGAGTTGTGTTCTTTGG No data
940057565_940057571 16 Left 940057565 2:149528967-149528989 CCCTAGTGGGTTAATTAGACCAT No data
Right 940057571 2:149529006-149529028 AGCATGAGAGTTGTGTTCTTTGG No data
940057568_940057571 -3 Left 940057568 2:149528986-149529008 CCATTGTCATCAGGTTCCCAAGC No data
Right 940057571 2:149529006-149529028 AGCATGAGAGTTGTGTTCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940057571 Original CRISPR AGCATGAGAGTTGTGTTCTT TGG Intergenic
No off target data available for this crispr