ID: 940063089

View in Genome Browser
Species Human (GRCh38)
Location 2:149594685-149594707
Sequence AACAGATGGCTAGAATATAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940063089_940063092 -1 Left 940063089 2:149594685-149594707 CCTGTATATTCTAGCCATCTGTT No data
Right 940063092 2:149594707-149594729 TGTTAGGTGAAATGCGTGAATGG No data
940063089_940063093 17 Left 940063089 2:149594685-149594707 CCTGTATATTCTAGCCATCTGTT No data
Right 940063093 2:149594725-149594747 AATGGCATAGAGAAATGTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940063089 Original CRISPR AACAGATGGCTAGAATATAC AGG (reversed) Intergenic