ID: 940063664

View in Genome Browser
Species Human (GRCh38)
Location 2:149601236-149601258
Sequence TGCAAGCCAGATGTATTGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940063664_940063665 -10 Left 940063664 2:149601236-149601258 CCTCTCAATACATCTGGCTTGCA No data
Right 940063665 2:149601249-149601271 CTGGCTTGCATAGTTTATGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940063664 Original CRISPR TGCAAGCCAGATGTATTGAG AGG (reversed) Intergenic
No off target data available for this crispr