ID: 940063665

View in Genome Browser
Species Human (GRCh38)
Location 2:149601249-149601271
Sequence CTGGCTTGCATAGTTTATGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940063663_940063665 -9 Left 940063663 2:149601235-149601257 CCCTCTCAATACATCTGGCTTGC No data
Right 940063665 2:149601249-149601271 CTGGCTTGCATAGTTTATGATGG No data
940063662_940063665 -8 Left 940063662 2:149601234-149601256 CCCCTCTCAATACATCTGGCTTG No data
Right 940063665 2:149601249-149601271 CTGGCTTGCATAGTTTATGATGG No data
940063664_940063665 -10 Left 940063664 2:149601236-149601258 CCTCTCAATACATCTGGCTTGCA No data
Right 940063665 2:149601249-149601271 CTGGCTTGCATAGTTTATGATGG No data
940063661_940063665 -7 Left 940063661 2:149601233-149601255 CCCCCTCTCAATACATCTGGCTT No data
Right 940063665 2:149601249-149601271 CTGGCTTGCATAGTTTATGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940063665 Original CRISPR CTGGCTTGCATAGTTTATGA TGG Intergenic
No off target data available for this crispr