ID: 940063841

View in Genome Browser
Species Human (GRCh38)
Location 2:149604170-149604192
Sequence TGTCATATAGCTATCTTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940063841_940063845 1 Left 940063841 2:149604170-149604192 CCTCCCAAGATAGCTATATGACA No data
Right 940063845 2:149604194-149604216 TTTGATTAGACCAGTAATCAGGG No data
940063841_940063844 0 Left 940063841 2:149604170-149604192 CCTCCCAAGATAGCTATATGACA No data
Right 940063844 2:149604193-149604215 ATTTGATTAGACCAGTAATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940063841 Original CRISPR TGTCATATAGCTATCTTGGG AGG (reversed) Intergenic
No off target data available for this crispr