ID: 940067605

View in Genome Browser
Species Human (GRCh38)
Location 2:149647454-149647476
Sequence GAACCTACCTGCAAGGGTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940067601_940067605 -9 Left 940067601 2:149647440-149647462 CCAGATCTCATCCAGAACCTACC No data
Right 940067605 2:149647454-149647476 GAACCTACCTGCAAGGGTTCTGG No data
940067598_940067605 27 Left 940067598 2:149647404-149647426 CCAAAATTTTGTGTCAGCACATT No data
Right 940067605 2:149647454-149647476 GAACCTACCTGCAAGGGTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940067605 Original CRISPR GAACCTACCTGCAAGGGTTC TGG Intergenic
No off target data available for this crispr