ID: 940068009

View in Genome Browser
Species Human (GRCh38)
Location 2:149651449-149651471
Sequence TAATTATCCACAGGTTGTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940068009_940068017 29 Left 940068009 2:149651449-149651471 CCAACACAACCTGTGGATAATTA No data
Right 940068017 2:149651501-149651523 TCTTGCATGCAGATGATCAAAGG No data
940068009_940068011 0 Left 940068009 2:149651449-149651471 CCAACACAACCTGTGGATAATTA No data
Right 940068011 2:149651472-149651494 ACATTGTCCTCCCCGCTTGCAGG No data
940068009_940068012 1 Left 940068009 2:149651449-149651471 CCAACACAACCTGTGGATAATTA No data
Right 940068012 2:149651473-149651495 CATTGTCCTCCCCGCTTGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940068009 Original CRISPR TAATTATCCACAGGTTGTGT TGG (reversed) Intergenic
No off target data available for this crispr