ID: 940068013

View in Genome Browser
Species Human (GRCh38)
Location 2:149651479-149651501
Sequence ACTGCTCCCTGCAAGCGGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940068013_940068017 -1 Left 940068013 2:149651479-149651501 CCTCCCCGCTTGCAGGGAGCAGT No data
Right 940068017 2:149651501-149651523 TCTTGCATGCAGATGATCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940068013 Original CRISPR ACTGCTCCCTGCAAGCGGGG AGG (reversed) Intergenic
No off target data available for this crispr