ID: 940068017

View in Genome Browser
Species Human (GRCh38)
Location 2:149651501-149651523
Sequence TCTTGCATGCAGATGATCAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940068016_940068017 -6 Left 940068016 2:149651484-149651506 CCGCTTGCAGGGAGCAGTCTTGC No data
Right 940068017 2:149651501-149651523 TCTTGCATGCAGATGATCAAAGG No data
940068014_940068017 -4 Left 940068014 2:149651482-149651504 CCCCGCTTGCAGGGAGCAGTCTT No data
Right 940068017 2:149651501-149651523 TCTTGCATGCAGATGATCAAAGG No data
940068013_940068017 -1 Left 940068013 2:149651479-149651501 CCTCCCCGCTTGCAGGGAGCAGT No data
Right 940068017 2:149651501-149651523 TCTTGCATGCAGATGATCAAAGG No data
940068010_940068017 20 Left 940068010 2:149651458-149651480 CCTGTGGATAATTAACATTGTCC No data
Right 940068017 2:149651501-149651523 TCTTGCATGCAGATGATCAAAGG No data
940068015_940068017 -5 Left 940068015 2:149651483-149651505 CCCGCTTGCAGGGAGCAGTCTTG No data
Right 940068017 2:149651501-149651523 TCTTGCATGCAGATGATCAAAGG No data
940068009_940068017 29 Left 940068009 2:149651449-149651471 CCAACACAACCTGTGGATAATTA No data
Right 940068017 2:149651501-149651523 TCTTGCATGCAGATGATCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940068017 Original CRISPR TCTTGCATGCAGATGATCAA AGG Intergenic
No off target data available for this crispr