ID: 940070373

View in Genome Browser
Species Human (GRCh38)
Location 2:149679901-149679923
Sequence CATGGCTACTACTTACAAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940070372_940070373 -7 Left 940070372 2:149679885-149679907 CCTTTTATTCACTGATCATGGCT No data
Right 940070373 2:149679901-149679923 CATGGCTACTACTTACAAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940070373 Original CRISPR CATGGCTACTACTTACAAGT AGG Intergenic
No off target data available for this crispr