ID: 940070913

View in Genome Browser
Species Human (GRCh38)
Location 2:149686890-149686912
Sequence GCTAGGATCTTGGCTGATGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940070910_940070913 -2 Left 940070910 2:149686869-149686891 CCTCTCAATCTTCTTCAGCTGGC No data
Right 940070913 2:149686890-149686912 GCTAGGATCTTGGCTGATGCAGG No data
940070908_940070913 2 Left 940070908 2:149686865-149686887 CCTGCCTCTCAATCTTCTTCAGC No data
Right 940070913 2:149686890-149686912 GCTAGGATCTTGGCTGATGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940070913 Original CRISPR GCTAGGATCTTGGCTGATGC AGG Intergenic
No off target data available for this crispr