ID: 940071036

View in Genome Browser
Species Human (GRCh38)
Location 2:149688127-149688149
Sequence CTGAACAGTGGCAAGGTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940071036_940071040 8 Left 940071036 2:149688127-149688149 CCATCCACCTTGCCACTGTTCAG No data
Right 940071040 2:149688158-149688180 TAGTGCACATGATATTGTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940071036 Original CRISPR CTGAACAGTGGCAAGGTGGA TGG (reversed) Intergenic
No off target data available for this crispr