ID: 940071876

View in Genome Browser
Species Human (GRCh38)
Location 2:149697875-149697897
Sequence ATCCATTGGCTGTCAGGTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940071872_940071876 14 Left 940071872 2:149697838-149697860 CCCAAAAGTGGAAAATTTAATTT No data
Right 940071876 2:149697875-149697897 ATCCATTGGCTGTCAGGTGATGG No data
940071873_940071876 13 Left 940071873 2:149697839-149697861 CCAAAAGTGGAAAATTTAATTTT No data
Right 940071876 2:149697875-149697897 ATCCATTGGCTGTCAGGTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940071876 Original CRISPR ATCCATTGGCTGTCAGGTGA TGG Intergenic
No off target data available for this crispr