ID: 940073411

View in Genome Browser
Species Human (GRCh38)
Location 2:149714716-149714738
Sequence TTTTTGTTCTTTAAGTTTCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940073411_940073414 4 Left 940073411 2:149714716-149714738 CCCCGAAACTTAAAGAACAAAAA No data
Right 940073414 2:149714743-149714765 AATTAAAATTTTTTAAAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940073411 Original CRISPR TTTTTGTTCTTTAAGTTTCG GGG (reversed) Intergenic
No off target data available for this crispr