ID: 940094074

View in Genome Browser
Species Human (GRCh38)
Location 2:149953602-149953624
Sequence CCCTGACCTCAGCCATCCTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940094074_940094077 -5 Left 940094074 2:149953602-149953624 CCCAAGGATGGCTGAGGTCAGGG No data
Right 940094077 2:149953620-149953642 CAGGGAATAAAATAACCATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940094074 Original CRISPR CCCTGACCTCAGCCATCCTT GGG (reversed) Intergenic
No off target data available for this crispr