ID: 940094077

View in Genome Browser
Species Human (GRCh38)
Location 2:149953620-149953642
Sequence CAGGGAATAAAATAACCATG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940094076_940094077 -6 Left 940094076 2:149953603-149953625 CCAAGGATGGCTGAGGTCAGGGA No data
Right 940094077 2:149953620-149953642 CAGGGAATAAAATAACCATGAGG No data
940094074_940094077 -5 Left 940094074 2:149953602-149953624 CCCAAGGATGGCTGAGGTCAGGG No data
Right 940094077 2:149953620-149953642 CAGGGAATAAAATAACCATGAGG No data
940094070_940094077 10 Left 940094070 2:149953587-149953609 CCACAGAAAGACATTCCCAAGGA No data
Right 940094077 2:149953620-149953642 CAGGGAATAAAATAACCATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940094077 Original CRISPR CAGGGAATAAAATAACCATG AGG Intergenic