ID: 940096090 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:149977866-149977888 |
| Sequence | CCTTCAGAAGGACCTGCTTG AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 940096090_940096095 | 9 | Left | 940096090 | 2:149977866-149977888 | CCTCAAGCAGGTCCTTCTGAAGG | No data | ||
| Right | 940096095 | 2:149977898-149977920 | AGAAGGCATTACTATCATAATGG | No data | ||||
| 940096090_940096093 | -8 | Left | 940096090 | 2:149977866-149977888 | CCTCAAGCAGGTCCTTCTGAAGG | No data | ||
| Right | 940096093 | 2:149977881-149977903 | TCTGAAGGTATTCCAAAAGAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 940096090 | Original CRISPR | CCTTCAGAAGGACCTGCTTG AGG (reversed) | Intergenic | ||