ID: 940096090

View in Genome Browser
Species Human (GRCh38)
Location 2:149977866-149977888
Sequence CCTTCAGAAGGACCTGCTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940096090_940096095 9 Left 940096090 2:149977866-149977888 CCTCAAGCAGGTCCTTCTGAAGG No data
Right 940096095 2:149977898-149977920 AGAAGGCATTACTATCATAATGG No data
940096090_940096093 -8 Left 940096090 2:149977866-149977888 CCTCAAGCAGGTCCTTCTGAAGG No data
Right 940096093 2:149977881-149977903 TCTGAAGGTATTCCAAAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940096090 Original CRISPR CCTTCAGAAGGACCTGCTTG AGG (reversed) Intergenic