ID: 940097412

View in Genome Browser
Species Human (GRCh38)
Location 2:149993331-149993353
Sequence GGACACACTATTCCAAAATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940097412_940097420 24 Left 940097412 2:149993331-149993353 CCATATTTTGGAATAGTGTGTCC No data
Right 940097420 2:149993378-149993400 TAGAGTCCCTGTGGCCTTGTGGG No data
940097412_940097417 15 Left 940097412 2:149993331-149993353 CCATATTTTGGAATAGTGTGTCC No data
Right 940097417 2:149993369-149993391 GCCAGCATCTAGAGTCCCTGTGG No data
940097412_940097413 -10 Left 940097412 2:149993331-149993353 CCATATTTTGGAATAGTGTGTCC No data
Right 940097413 2:149993344-149993366 TAGTGTGTCCTGAACCCATCAGG No data
940097412_940097419 23 Left 940097412 2:149993331-149993353 CCATATTTTGGAATAGTGTGTCC No data
Right 940097419 2:149993377-149993399 CTAGAGTCCCTGTGGCCTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940097412 Original CRISPR GGACACACTATTCCAAAATA TGG (reversed) Intergenic
No off target data available for this crispr