ID: 940098082

View in Genome Browser
Species Human (GRCh38)
Location 2:150001394-150001416
Sequence AAATTTAGACCACATGCTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940098082_940098086 8 Left 940098082 2:150001394-150001416 CCTGAAGCATGTGGTCTAAATTT No data
Right 940098086 2:150001425-150001447 TGATGCTTCTGCCAGGAATTTGG No data
940098082_940098083 1 Left 940098082 2:150001394-150001416 CCTGAAGCATGTGGTCTAAATTT No data
Right 940098083 2:150001418-150001440 ACCCATCTGATGCTTCTGCCAGG No data
940098082_940098087 15 Left 940098082 2:150001394-150001416 CCTGAAGCATGTGGTCTAAATTT No data
Right 940098087 2:150001432-150001454 TCTGCCAGGAATTTGGCTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940098082 Original CRISPR AAATTTAGACCACATGCTTC AGG (reversed) Intergenic
No off target data available for this crispr