ID: 940098083

View in Genome Browser
Species Human (GRCh38)
Location 2:150001418-150001440
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940098082_940098083 1 Left 940098082 2:150001394-150001416 CCTGAAGCATGTGGTCTAAATTT No data
Right 940098083 2:150001418-150001440 ACCCATCTGATGCTTCTGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr