ID: 940100289

View in Genome Browser
Species Human (GRCh38)
Location 2:150029703-150029725
Sequence TGGGACACTCCTGCTCCCTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940100289_940100295 13 Left 940100289 2:150029703-150029725 CCAAAGGGAGCAGGAGTGTCCCA No data
Right 940100295 2:150029739-150029761 ACTTAGTATGATGAATGGCAGGG No data
940100289_940100293 8 Left 940100289 2:150029703-150029725 CCAAAGGGAGCAGGAGTGTCCCA No data
Right 940100293 2:150029734-150029756 AAGATACTTAGTATGATGAATGG No data
940100289_940100294 12 Left 940100289 2:150029703-150029725 CCAAAGGGAGCAGGAGTGTCCCA No data
Right 940100294 2:150029738-150029760 TACTTAGTATGATGAATGGCAGG No data
940100289_940100296 23 Left 940100289 2:150029703-150029725 CCAAAGGGAGCAGGAGTGTCCCA No data
Right 940100296 2:150029749-150029771 ATGAATGGCAGGGCAAAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940100289 Original CRISPR TGGGACACTCCTGCTCCCTT TGG (reversed) Intergenic
No off target data available for this crispr