ID: 940105139

View in Genome Browser
Species Human (GRCh38)
Location 2:150091042-150091064
Sequence AGTGGTCAAAATTAAAAGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940105139_940105142 -10 Left 940105139 2:150091042-150091064 CCAAGCTTTTAATTTTGACCACT No data
Right 940105142 2:150091055-150091077 TTTGACCACTTGGGTTAGATTGG No data
940105139_940105143 -9 Left 940105139 2:150091042-150091064 CCAAGCTTTTAATTTTGACCACT No data
Right 940105143 2:150091056-150091078 TTGACCACTTGGGTTAGATTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940105139 Original CRISPR AGTGGTCAAAATTAAAAGCT TGG (reversed) Intergenic
No off target data available for this crispr