ID: 940106748

View in Genome Browser
Species Human (GRCh38)
Location 2:150109801-150109823
Sequence TAAGATGCTCCCTGTCTAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940106746_940106748 16 Left 940106746 2:150109762-150109784 CCTTAATATCAAAAATGTTAAAG No data
Right 940106748 2:150109801-150109823 TAAGATGCTCCCTGTCTAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940106748 Original CRISPR TAAGATGCTCCCTGTCTAGC AGG Intergenic
No off target data available for this crispr