ID: 940108953

View in Genome Browser
Species Human (GRCh38)
Location 2:150129275-150129297
Sequence AATTTGCATCAGGTGTATAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940108951_940108953 -8 Left 940108951 2:150129260-150129282 CCATACTTGGAGAAAAATTTGCA No data
Right 940108953 2:150129275-150129297 AATTTGCATCAGGTGTATAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940108953 Original CRISPR AATTTGCATCAGGTGTATAG TGG Intergenic
No off target data available for this crispr