ID: 940112903

View in Genome Browser
Species Human (GRCh38)
Location 2:150173765-150173787
Sequence GCTACTGTTGCCCCAGTAGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940112903_940112909 17 Left 940112903 2:150173765-150173787 CCCGCTACTGGGGCAACAGTAGC No data
Right 940112909 2:150173805-150173827 GAGAATAGCTTGAACCTGGGAGG 0: 1199
1: 47503
2: 119967
3: 192699
4: 169176
940112903_940112910 20 Left 940112903 2:150173765-150173787 CCCGCTACTGGGGCAACAGTAGC No data
Right 940112910 2:150173808-150173830 AATAGCTTGAACCTGGGAGGTGG 0: 787
1: 31840
2: 80033
3: 128162
4: 107761
940112903_940112906 -9 Left 940112903 2:150173765-150173787 CCCGCTACTGGGGCAACAGTAGC No data
Right 940112906 2:150173779-150173801 AACAGTAGCTACTGAGGTTGAGG No data
940112903_940112908 14 Left 940112903 2:150173765-150173787 CCCGCTACTGGGGCAACAGTAGC No data
Right 940112908 2:150173802-150173824 CAAGAGAATAGCTTGAACCTGGG 0: 74
1: 3511
2: 57746
3: 176082
4: 230042
940112903_940112907 13 Left 940112903 2:150173765-150173787 CCCGCTACTGGGGCAACAGTAGC No data
Right 940112907 2:150173801-150173823 GCAAGAGAATAGCTTGAACCTGG 0: 134
1: 5854
2: 90148
3: 172685
4: 108175
940112903_940112911 23 Left 940112903 2:150173765-150173787 CCCGCTACTGGGGCAACAGTAGC No data
Right 940112911 2:150173811-150173833 AGCTTGAACCTGGGAGGTGGAGG 0: 377
1: 14771
2: 48894
3: 101538
4: 136758

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940112903 Original CRISPR GCTACTGTTGCCCCAGTAGC GGG (reversed) Intergenic
No off target data available for this crispr