ID: 940114091

View in Genome Browser
Species Human (GRCh38)
Location 2:150188752-150188774
Sequence GGGTATACACAGATTTATTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940114084_940114091 16 Left 940114084 2:150188713-150188735 CCATCAGCATTTAAGCCAATGGT No data
Right 940114091 2:150188752-150188774 GGGTATACACAGATTTATTTGGG No data
940114085_940114091 1 Left 940114085 2:150188728-150188750 CCAATGGTTTATACATATTCCCG No data
Right 940114091 2:150188752-150188774 GGGTATACACAGATTTATTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940114091 Original CRISPR GGGTATACACAGATTTATTT GGG Intergenic
No off target data available for this crispr