ID: 940118596

View in Genome Browser
Species Human (GRCh38)
Location 2:150238090-150238112
Sequence TTCAAGGTACATATTCTGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940118592_940118596 -5 Left 940118592 2:150238072-150238094 CCTGAAGGACACCAAACATTCAA No data
Right 940118596 2:150238090-150238112 TTCAAGGTACATATTCTGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940118596 Original CRISPR TTCAAGGTACATATTCTGGT TGG Intergenic
No off target data available for this crispr