ID: 940120021

View in Genome Browser
Species Human (GRCh38)
Location 2:150253938-150253960
Sequence CCTTATATGCAGCTCTTCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940120021_940120031 29 Left 940120021 2:150253938-150253960 CCCTGGAAGAGCTGCATATAAGG No data
Right 940120031 2:150253990-150254012 AACTCCAAAGGAGTAGTCAAGGG No data
940120021_940120027 -7 Left 940120021 2:150253938-150253960 CCCTGGAAGAGCTGCATATAAGG No data
Right 940120027 2:150253954-150253976 TATAAGGGAATAGAGGGTGACGG No data
940120021_940120029 17 Left 940120021 2:150253938-150253960 CCCTGGAAGAGCTGCATATAAGG No data
Right 940120029 2:150253978-150254000 GTTAGTAGAGGAAACTCCAAAGG No data
940120021_940120030 28 Left 940120021 2:150253938-150253960 CCCTGGAAGAGCTGCATATAAGG No data
Right 940120030 2:150253989-150254011 AAACTCCAAAGGAGTAGTCAAGG No data
940120021_940120028 5 Left 940120021 2:150253938-150253960 CCCTGGAAGAGCTGCATATAAGG No data
Right 940120028 2:150253966-150253988 GAGGGTGACGGAGTTAGTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940120021 Original CRISPR CCTTATATGCAGCTCTTCCA GGG (reversed) Intergenic
No off target data available for this crispr