ID: 940120027

View in Genome Browser
Species Human (GRCh38)
Location 2:150253954-150253976
Sequence TATAAGGGAATAGAGGGTGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940120021_940120027 -7 Left 940120021 2:150253938-150253960 CCCTGGAAGAGCTGCATATAAGG No data
Right 940120027 2:150253954-150253976 TATAAGGGAATAGAGGGTGACGG No data
940120023_940120027 -8 Left 940120023 2:150253939-150253961 CCTGGAAGAGCTGCATATAAGGG No data
Right 940120027 2:150253954-150253976 TATAAGGGAATAGAGGGTGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940120027 Original CRISPR TATAAGGGAATAGAGGGTGA CGG Intergenic
No off target data available for this crispr