ID: 940120030

View in Genome Browser
Species Human (GRCh38)
Location 2:150253989-150254011
Sequence AAACTCCAAAGGAGTAGTCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940120023_940120030 27 Left 940120023 2:150253939-150253961 CCTGGAAGAGCTGCATATAAGGG No data
Right 940120030 2:150253989-150254011 AAACTCCAAAGGAGTAGTCAAGG No data
940120021_940120030 28 Left 940120021 2:150253938-150253960 CCCTGGAAGAGCTGCATATAAGG No data
Right 940120030 2:150253989-150254011 AAACTCCAAAGGAGTAGTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940120030 Original CRISPR AAACTCCAAAGGAGTAGTCA AGG Intergenic
No off target data available for this crispr