ID: 940125008

View in Genome Browser
Species Human (GRCh38)
Location 2:150312579-150312601
Sequence ATTTCGTATCTGGCCAAACT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940125004_940125008 24 Left 940125004 2:150312532-150312554 CCAATACTCAACATTCTTAAAAA No data
Right 940125008 2:150312579-150312601 ATTTCGTATCTGGCCAAACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940125008 Original CRISPR ATTTCGTATCTGGCCAAACT AGG Intergenic
No off target data available for this crispr