ID: 940127959

View in Genome Browser
Species Human (GRCh38)
Location 2:150348254-150348276
Sequence CTGTATATACAAATGACCAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940127954_940127959 24 Left 940127954 2:150348207-150348229 CCTTAACAAATGACTAATATAAG No data
Right 940127959 2:150348254-150348276 CTGTATATACAAATGACCAAAGG No data
940127958_940127959 -8 Left 940127958 2:150348239-150348261 CCATATGGTGGTATGCTGTATAT No data
Right 940127959 2:150348254-150348276 CTGTATATACAAATGACCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940127959 Original CRISPR CTGTATATACAAATGACCAA AGG Intergenic
No off target data available for this crispr