ID: 940136286

View in Genome Browser
Species Human (GRCh38)
Location 2:150439769-150439791
Sequence GGGAACAGGCACAAGACTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940136286_940136289 -3 Left 940136286 2:150439769-150439791 CCTGCAGTCTTGTGCCTGTTCCC No data
Right 940136289 2:150439789-150439811 CCCTCCAATCTGTCTCCACATGG No data
940136286_940136292 6 Left 940136286 2:150439769-150439791 CCTGCAGTCTTGTGCCTGTTCCC No data
Right 940136292 2:150439798-150439820 CTGTCTCCACATGGAAGACGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940136286 Original CRISPR GGGAACAGGCACAAGACTGC AGG (reversed) Intergenic
No off target data available for this crispr