ID: 940136289

View in Genome Browser
Species Human (GRCh38)
Location 2:150439789-150439811
Sequence CCCTCCAATCTGTCTCCACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940136286_940136289 -3 Left 940136286 2:150439769-150439791 CCTGCAGTCTTGTGCCTGTTCCC No data
Right 940136289 2:150439789-150439811 CCCTCCAATCTGTCTCCACATGG No data
940136285_940136289 1 Left 940136285 2:150439765-150439787 CCTGCCTGCAGTCTTGTGCCTGT No data
Right 940136289 2:150439789-150439811 CCCTCCAATCTGTCTCCACATGG No data
940136284_940136289 13 Left 940136284 2:150439753-150439775 CCTAATTCATCTCCTGCCTGCAG No data
Right 940136289 2:150439789-150439811 CCCTCCAATCTGTCTCCACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940136289 Original CRISPR CCCTCCAATCTGTCTCCACA TGG Intergenic
No off target data available for this crispr