ID: 940136292

View in Genome Browser
Species Human (GRCh38)
Location 2:150439798-150439820
Sequence CTGTCTCCACATGGAAGACG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940136287_940136292 -8 Left 940136287 2:150439783-150439805 CCTGTTCCCTCCAATCTGTCTCC No data
Right 940136292 2:150439798-150439820 CTGTCTCCACATGGAAGACGTGG No data
940136285_940136292 10 Left 940136285 2:150439765-150439787 CCTGCCTGCAGTCTTGTGCCTGT No data
Right 940136292 2:150439798-150439820 CTGTCTCCACATGGAAGACGTGG No data
940136284_940136292 22 Left 940136284 2:150439753-150439775 CCTAATTCATCTCCTGCCTGCAG No data
Right 940136292 2:150439798-150439820 CTGTCTCCACATGGAAGACGTGG No data
940136286_940136292 6 Left 940136286 2:150439769-150439791 CCTGCAGTCTTGTGCCTGTTCCC No data
Right 940136292 2:150439798-150439820 CTGTCTCCACATGGAAGACGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940136292 Original CRISPR CTGTCTCCACATGGAAGACG TGG Intergenic
No off target data available for this crispr