ID: 940137466

View in Genome Browser
Species Human (GRCh38)
Location 2:150455005-150455027
Sequence ACCTATTAGGTTCCAGGTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940137463_940137466 -7 Left 940137463 2:150454989-150455011 CCAAAATTTATTGAGCACCTATT No data
Right 940137466 2:150455005-150455027 ACCTATTAGGTTCCAGGTACTGG No data
940137462_940137466 24 Left 940137462 2:150454958-150454980 CCTTTAGTCATGGATGTATTCAT No data
Right 940137466 2:150455005-150455027 ACCTATTAGGTTCCAGGTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940137466 Original CRISPR ACCTATTAGGTTCCAGGTAC TGG Intergenic
No off target data available for this crispr