ID: 940137468

View in Genome Browser
Species Human (GRCh38)
Location 2:150455006-150455028
Sequence CCTATTAGGTTCCAGGTACT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940137463_940137468 -6 Left 940137463 2:150454989-150455011 CCAAAATTTATTGAGCACCTATT No data
Right 940137468 2:150455006-150455028 CCTATTAGGTTCCAGGTACTGGG No data
940137462_940137468 25 Left 940137462 2:150454958-150454980 CCTTTAGTCATGGATGTATTCAT No data
Right 940137468 2:150455006-150455028 CCTATTAGGTTCCAGGTACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940137468 Original CRISPR CCTATTAGGTTCCAGGTACT GGG Intergenic
No off target data available for this crispr