ID: 940138387

View in Genome Browser
Species Human (GRCh38)
Location 2:150464960-150464982
Sequence TGCAAGGCATAGAATATTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940138387_940138394 11 Left 940138387 2:150464960-150464982 CCTCCAATATTCTATGCCTTGCA No data
Right 940138394 2:150464994-150465016 ATAATTATCATCTATCTCAAAGG No data
940138387_940138396 22 Left 940138387 2:150464960-150464982 CCTCCAATATTCTATGCCTTGCA No data
Right 940138396 2:150465005-150465027 CTATCTCAAAGGTGCTCAGGAGG No data
940138387_940138395 19 Left 940138387 2:150464960-150464982 CCTCCAATATTCTATGCCTTGCA No data
Right 940138395 2:150465002-150465024 CATCTATCTCAAAGGTGCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940138387 Original CRISPR TGCAAGGCATAGAATATTGG AGG (reversed) Intergenic
No off target data available for this crispr