ID: 940143446

View in Genome Browser
Species Human (GRCh38)
Location 2:150521312-150521334
Sequence ACCTTGGAGAGACAGCATTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940143437_940143446 23 Left 940143437 2:150521266-150521288 CCCTTTAGAGCACCACCACAGTC No data
Right 940143446 2:150521312-150521334 ACCTTGGAGAGACAGCATTAAGG No data
940143442_940143446 8 Left 940143442 2:150521281-150521303 CCACAGTCCACAAAAAGGGAGAG No data
Right 940143446 2:150521312-150521334 ACCTTGGAGAGACAGCATTAAGG No data
940143438_940143446 22 Left 940143438 2:150521267-150521289 CCTTTAGAGCACCACCACAGTCC No data
Right 940143446 2:150521312-150521334 ACCTTGGAGAGACAGCATTAAGG No data
940143443_940143446 1 Left 940143443 2:150521288-150521310 CCACAAAAAGGGAGAGACTTCCA No data
Right 940143446 2:150521312-150521334 ACCTTGGAGAGACAGCATTAAGG No data
940143441_940143446 11 Left 940143441 2:150521278-150521300 CCACCACAGTCCACAAAAAGGGA No data
Right 940143446 2:150521312-150521334 ACCTTGGAGAGACAGCATTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940143446 Original CRISPR ACCTTGGAGAGACAGCATTA AGG Intronic
No off target data available for this crispr