ID: 940144161

View in Genome Browser
Species Human (GRCh38)
Location 2:150527824-150527846
Sequence GGTGTGAGCCACTGTGCTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940144161_940144172 24 Left 940144161 2:150527824-150527846 CCACAAGCACAGTGGCTCACACC No data
Right 940144172 2:150527871-150527893 CAAGGTGGGAGGAATACTTGAGG No data
940144161_940144168 9 Left 940144161 2:150527824-150527846 CCACAAGCACAGTGGCTCACACC No data
Right 940144168 2:150527856-150527878 AGAACTTTGGAAGGCCAAGGTGG 0: 47
1: 3407
2: 66086
3: 155835
4: 161028
940144161_940144173 29 Left 940144161 2:150527824-150527846 CCACAAGCACAGTGGCTCACACC No data
Right 940144173 2:150527876-150527898 TGGGAGGAATACTTGAGGCCAGG No data
940144161_940144169 10 Left 940144161 2:150527824-150527846 CCACAAGCACAGTGGCTCACACC No data
Right 940144169 2:150527857-150527879 GAACTTTGGAAGGCCAAGGTGGG 0: 30
1: 2037
2: 38358
3: 145866
4: 243591
940144161_940144170 13 Left 940144161 2:150527824-150527846 CCACAAGCACAGTGGCTCACACC No data
Right 940144170 2:150527860-150527882 CTTTGGAAGGCCAAGGTGGGAGG 0: 885
1: 24065
2: 76396
3: 155349
4: 159486
940144161_940144162 -4 Left 940144161 2:150527824-150527846 CCACAAGCACAGTGGCTCACACC No data
Right 940144162 2:150527843-150527865 CACCTGTAATCCCAGAACTTTGG 0: 1535
1: 75870
2: 213055
3: 254444
4: 203232
940144161_940144164 0 Left 940144161 2:150527824-150527846 CCACAAGCACAGTGGCTCACACC No data
Right 940144164 2:150527847-150527869 TGTAATCCCAGAACTTTGGAAGG 0: 272
1: 16320
2: 319457
3: 264475
4: 143062
940144161_940144166 6 Left 940144161 2:150527824-150527846 CCACAAGCACAGTGGCTCACACC No data
Right 940144166 2:150527853-150527875 CCCAGAACTTTGGAAGGCCAAGG 0: 84
1: 5011
2: 95049
3: 217532
4: 235870

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940144161 Original CRISPR GGTGTGAGCCACTGTGCTTG TGG (reversed) Intronic
No off target data available for this crispr