ID: 940144162

View in Genome Browser
Species Human (GRCh38)
Location 2:150527843-150527865
Sequence CACCTGTAATCCCAGAACTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 748136
Summary {0: 1535, 1: 75870, 2: 213055, 3: 254444, 4: 203232}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940144158_940144162 7 Left 940144158 2:150527813-150527835 CCCTGACAATTCCACAAGCACAG No data
Right 940144162 2:150527843-150527865 CACCTGTAATCCCAGAACTTTGG 0: 1535
1: 75870
2: 213055
3: 254444
4: 203232
940144159_940144162 6 Left 940144159 2:150527814-150527836 CCTGACAATTCCACAAGCACAGT No data
Right 940144162 2:150527843-150527865 CACCTGTAATCCCAGAACTTTGG 0: 1535
1: 75870
2: 213055
3: 254444
4: 203232
940144161_940144162 -4 Left 940144161 2:150527824-150527846 CCACAAGCACAGTGGCTCACACC No data
Right 940144162 2:150527843-150527865 CACCTGTAATCCCAGAACTTTGG 0: 1535
1: 75870
2: 213055
3: 254444
4: 203232

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940144162 Original CRISPR CACCTGTAATCCCAGAACTT TGG Intronic
Too many off-targets to display for this crispr