ID: 940144163

View in Genome Browser
Species Human (GRCh38)
Location 2:150527845-150527867
Sequence TTCCAAAGTTCTGGGATTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 738510
Summary {0: 266, 1: 16102, 2: 316502, 3: 263404, 4: 142236}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940144163_940144170 -8 Left 940144163 2:150527845-150527867 CCTGTAATCCCAGAACTTTGGAA 0: 266
1: 16102
2: 316502
3: 263404
4: 142236
Right 940144170 2:150527860-150527882 CTTTGGAAGGCCAAGGTGGGAGG 0: 885
1: 24065
2: 76396
3: 155349
4: 159486
940144163_940144173 8 Left 940144163 2:150527845-150527867 CCTGTAATCCCAGAACTTTGGAA 0: 266
1: 16102
2: 316502
3: 263404
4: 142236
Right 940144173 2:150527876-150527898 TGGGAGGAATACTTGAGGCCAGG No data
940144163_940144176 26 Left 940144163 2:150527845-150527867 CCTGTAATCCCAGAACTTTGGAA 0: 266
1: 16102
2: 316502
3: 263404
4: 142236
Right 940144176 2:150527894-150527916 CCAGGAGTTCTGGACCAGTCTGG No data
940144163_940144172 3 Left 940144163 2:150527845-150527867 CCTGTAATCCCAGAACTTTGGAA 0: 266
1: 16102
2: 316502
3: 263404
4: 142236
Right 940144172 2:150527871-150527893 CAAGGTGGGAGGAATACTTGAGG No data
940144163_940144174 16 Left 940144163 2:150527845-150527867 CCTGTAATCCCAGAACTTTGGAA 0: 266
1: 16102
2: 316502
3: 263404
4: 142236
Right 940144174 2:150527884-150527906 ATACTTGAGGCCAGGAGTTCTGG No data
940144163_940144177 27 Left 940144163 2:150527845-150527867 CCTGTAATCCCAGAACTTTGGAA 0: 266
1: 16102
2: 316502
3: 263404
4: 142236
Right 940144177 2:150527895-150527917 CAGGAGTTCTGGACCAGTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940144163 Original CRISPR TTCCAAAGTTCTGGGATTAC AGG (reversed) Intronic
Too many off-targets to display for this crispr