ID: 940144164

View in Genome Browser
Species Human (GRCh38)
Location 2:150527847-150527869
Sequence TGTAATCCCAGAACTTTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 743586
Summary {0: 272, 1: 16320, 2: 319457, 3: 264475, 4: 143062}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940144158_940144164 11 Left 940144158 2:150527813-150527835 CCCTGACAATTCCACAAGCACAG No data
Right 940144164 2:150527847-150527869 TGTAATCCCAGAACTTTGGAAGG 0: 272
1: 16320
2: 319457
3: 264475
4: 143062
940144159_940144164 10 Left 940144159 2:150527814-150527836 CCTGACAATTCCACAAGCACAGT No data
Right 940144164 2:150527847-150527869 TGTAATCCCAGAACTTTGGAAGG 0: 272
1: 16320
2: 319457
3: 264475
4: 143062
940144161_940144164 0 Left 940144161 2:150527824-150527846 CCACAAGCACAGTGGCTCACACC No data
Right 940144164 2:150527847-150527869 TGTAATCCCAGAACTTTGGAAGG 0: 272
1: 16320
2: 319457
3: 264475
4: 143062

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940144164 Original CRISPR TGTAATCCCAGAACTTTGGA AGG Intronic
Too many off-targets to display for this crispr