ID: 940144166

View in Genome Browser
Species Human (GRCh38)
Location 2:150527853-150527875
Sequence CCCAGAACTTTGGAAGGCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 553546
Summary {0: 84, 1: 5011, 2: 95049, 3: 217532, 4: 235870}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940144159_940144166 16 Left 940144159 2:150527814-150527836 CCTGACAATTCCACAAGCACAGT No data
Right 940144166 2:150527853-150527875 CCCAGAACTTTGGAAGGCCAAGG 0: 84
1: 5011
2: 95049
3: 217532
4: 235870
940144158_940144166 17 Left 940144158 2:150527813-150527835 CCCTGACAATTCCACAAGCACAG No data
Right 940144166 2:150527853-150527875 CCCAGAACTTTGGAAGGCCAAGG 0: 84
1: 5011
2: 95049
3: 217532
4: 235870
940144161_940144166 6 Left 940144161 2:150527824-150527846 CCACAAGCACAGTGGCTCACACC No data
Right 940144166 2:150527853-150527875 CCCAGAACTTTGGAAGGCCAAGG 0: 84
1: 5011
2: 95049
3: 217532
4: 235870

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940144166 Original CRISPR CCCAGAACTTTGGAAGGCCA AGG Intronic
Too many off-targets to display for this crispr