ID: 940144168

View in Genome Browser
Species Human (GRCh38)
Location 2:150527856-150527878
Sequence AGAACTTTGGAAGGCCAAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 386403
Summary {0: 47, 1: 3407, 2: 66086, 3: 155835, 4: 161028}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940144161_940144168 9 Left 940144161 2:150527824-150527846 CCACAAGCACAGTGGCTCACACC No data
Right 940144168 2:150527856-150527878 AGAACTTTGGAAGGCCAAGGTGG 0: 47
1: 3407
2: 66086
3: 155835
4: 161028
940144159_940144168 19 Left 940144159 2:150527814-150527836 CCTGACAATTCCACAAGCACAGT No data
Right 940144168 2:150527856-150527878 AGAACTTTGGAAGGCCAAGGTGG 0: 47
1: 3407
2: 66086
3: 155835
4: 161028
940144158_940144168 20 Left 940144158 2:150527813-150527835 CCCTGACAATTCCACAAGCACAG No data
Right 940144168 2:150527856-150527878 AGAACTTTGGAAGGCCAAGGTGG 0: 47
1: 3407
2: 66086
3: 155835
4: 161028

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940144168 Original CRISPR AGAACTTTGGAAGGCCAAGG TGG Intronic
Too many off-targets to display for this crispr