ID: 940144169

View in Genome Browser
Species Human (GRCh38)
Location 2:150527857-150527879
Sequence GAACTTTGGAAGGCCAAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 429882
Summary {0: 30, 1: 2037, 2: 38358, 3: 145866, 4: 243591}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940144158_940144169 21 Left 940144158 2:150527813-150527835 CCCTGACAATTCCACAAGCACAG No data
Right 940144169 2:150527857-150527879 GAACTTTGGAAGGCCAAGGTGGG 0: 30
1: 2037
2: 38358
3: 145866
4: 243591
940144161_940144169 10 Left 940144161 2:150527824-150527846 CCACAAGCACAGTGGCTCACACC No data
Right 940144169 2:150527857-150527879 GAACTTTGGAAGGCCAAGGTGGG 0: 30
1: 2037
2: 38358
3: 145866
4: 243591
940144159_940144169 20 Left 940144159 2:150527814-150527836 CCTGACAATTCCACAAGCACAGT No data
Right 940144169 2:150527857-150527879 GAACTTTGGAAGGCCAAGGTGGG 0: 30
1: 2037
2: 38358
3: 145866
4: 243591

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940144169 Original CRISPR GAACTTTGGAAGGCCAAGGT GGG Intronic
Too many off-targets to display for this crispr