ID: 940144170

View in Genome Browser
Species Human (GRCh38)
Location 2:150527860-150527882
Sequence CTTTGGAAGGCCAAGGTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 416181
Summary {0: 885, 1: 24065, 2: 76396, 3: 155349, 4: 159486}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940144163_940144170 -8 Left 940144163 2:150527845-150527867 CCTGTAATCCCAGAACTTTGGAA 0: 266
1: 16102
2: 316502
3: 263404
4: 142236
Right 940144170 2:150527860-150527882 CTTTGGAAGGCCAAGGTGGGAGG 0: 885
1: 24065
2: 76396
3: 155349
4: 159486
940144159_940144170 23 Left 940144159 2:150527814-150527836 CCTGACAATTCCACAAGCACAGT No data
Right 940144170 2:150527860-150527882 CTTTGGAAGGCCAAGGTGGGAGG 0: 885
1: 24065
2: 76396
3: 155349
4: 159486
940144161_940144170 13 Left 940144161 2:150527824-150527846 CCACAAGCACAGTGGCTCACACC No data
Right 940144170 2:150527860-150527882 CTTTGGAAGGCCAAGGTGGGAGG 0: 885
1: 24065
2: 76396
3: 155349
4: 159486
940144158_940144170 24 Left 940144158 2:150527813-150527835 CCCTGACAATTCCACAAGCACAG No data
Right 940144170 2:150527860-150527882 CTTTGGAAGGCCAAGGTGGGAGG 0: 885
1: 24065
2: 76396
3: 155349
4: 159486

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940144170 Original CRISPR CTTTGGAAGGCCAAGGTGGG AGG Intronic
Too many off-targets to display for this crispr