ID: 940146118

View in Genome Browser
Species Human (GRCh38)
Location 2:150546018-150546040
Sequence TGGCACGGACATGAGCGGAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940146118_940146122 1 Left 940146118 2:150546018-150546040 CCTATCCGCTCATGTCCGTGCCA No data
Right 940146122 2:150546042-150546064 TGAACCAGCTGTTTTTGAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940146118 Original CRISPR TGGCACGGACATGAGCGGAT AGG (reversed) Intergenic
No off target data available for this crispr