ID: 940146574

View in Genome Browser
Species Human (GRCh38)
Location 2:150551456-150551478
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940146564_940146574 12 Left 940146564 2:150551421-150551443 CCGAATCATCCTTTAGGAACGAA No data
Right 940146574 2:150551456-150551478 TAGGAAGCCCACAGTGGCAGGGG No data
940146565_940146574 3 Left 940146565 2:150551430-150551452 CCTTTAGGAACGAAGACCCCCAT No data
Right 940146574 2:150551456-150551478 TAGGAAGCCCACAGTGGCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr