ID: 940148192

View in Genome Browser
Species Human (GRCh38)
Location 2:150570112-150570134
Sequence CTCAATACACAATGCAAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 225
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 210}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940148186_940148192 26 Left 940148186 2:150570063-150570085 CCATCATTGAAAAGAGAGACGAT 0: 1
1: 0
2: 0
3: 15
4: 139
Right 940148192 2:150570112-150570134 CTCAATACACAATGCAAGGAGGG 0: 1
1: 0
2: 0
3: 14
4: 210

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940148192 Original CRISPR CTCAATACACAATGCAAGGA GGG Intergenic
903374134 1:22855105-22855127 TTCAATCCACAATCCAAGGAAGG - Intronic
904191891 1:28751562-28751584 ATCTATTCACAAAGCAAGGAAGG - Intronic
908206940 1:61859948-61859970 CTCAATCCACAGTGCAAGTGGGG + Intronic
909240667 1:73208885-73208907 CTCAAGACACTATGCAATGAAGG + Intergenic
911211394 1:95142462-95142484 CAAAATGCACAAAGCAAGGAAGG + Intronic
916640131 1:166718438-166718460 CCCAATAGATAATGCAATGAAGG - Intergenic
916746355 1:167687713-167687735 CCCAATGCACAGTGCCAGGAAGG + Intronic
917802429 1:178582555-178582577 CTCAAAAGAAAATGCAAAGATGG + Intergenic
921675470 1:217970714-217970736 CTCAATAAACTAGGCAATGAAGG - Intergenic
922915849 1:229257025-229257047 CTTATTACACAAAGAAAGGAAGG - Intergenic
923092297 1:230749876-230749898 GTCAATATAGACTGCAAGGATGG - Intronic
923455046 1:234157551-234157573 CTGAAAACACAGTGCAAGCATGG + Intronic
1064713676 10:18152994-18153016 CCCAATTCACATGGCAAGGAGGG + Intronic
1065065445 10:21959013-21959035 CTCAGTACAGAATGCATGGAAGG + Intronic
1065665159 10:28051347-28051369 ATCATTACACAATACCAGGAAGG + Exonic
1066299505 10:34084474-34084496 TTCAATAAACAATGGATGGATGG + Intergenic
1066424804 10:35297323-35297345 CTCAATAAACAAGGCATTGAAGG + Intronic
1067669774 10:48307738-48307760 CTCAAAACACAATGGACTGACGG - Intronic
1070990232 10:80725754-80725776 CTGAATACATAATGAAATGAAGG - Intergenic
1071000074 10:80821647-80821669 CTCAATAAACTAGGCATGGATGG + Intergenic
1071011674 10:80947643-80947665 CAAAACACACAAAGCAAGGAAGG + Intergenic
1071909454 10:90214450-90214472 TGCATTGCACAATGCAAGGAGGG + Intergenic
1072357662 10:94627347-94627369 CTCAATACACTATGCATACATGG - Intergenic
1076430657 10:130399621-130399643 CTCAGTGCACAGTGAAAGGAAGG - Intergenic
1077714200 11:4565295-4565317 ATGAATACCCAATGCATGGAAGG + Intergenic
1079600024 11:22299895-22299917 CAGAACACAGAATGCAAGGAAGG + Intergenic
1081194466 11:40144337-40144359 CTCAATAAACAATGAATGAAGGG - Intronic
1083376247 11:62224313-62224335 CCCAATAGATAATCCAAGGAAGG - Intergenic
1083645313 11:64168856-64168878 CTCACTAGACATTGCCAGGAAGG - Intergenic
1083911124 11:65710751-65710773 CAAAATGCACAAAGCAAGGAAGG - Intergenic
1085850447 11:80113326-80113348 CTCAATACACTATGCACTGATGG + Intergenic
1086172608 11:83852844-83852866 CTCAATTGAGAAAGCAAGGATGG - Intronic
1086760566 11:90625342-90625364 CTCAATACACTTTGCAAGAGTGG + Intergenic
1087341286 11:96910818-96910840 CTGGATACACAATGAAATGAAGG + Intergenic
1087418241 11:97886037-97886059 ATCACTACAGAATGCAAGTATGG - Intergenic
1089458801 11:118640990-118641012 GTCAATACAAAATCCAAGGCAGG - Intronic
1089741117 11:120584735-120584757 CTCAACACACTATGCACTGAAGG - Intronic
1090552197 11:127833510-127833532 CTCAATAAACAAGGAAAAGAGGG + Intergenic
1094029112 12:25990623-25990645 CGCAATACACAATGTTAGTAAGG - Intronic
1094769920 12:33644040-33644062 CTTAATATACAATGGAAGGTGGG + Intergenic
1096095753 12:48934547-48934569 CTCAATTTAGAATGCCAGGAAGG - Intronic
1096900136 12:54868830-54868852 CTCAATATACCTTGTAAGGAAGG - Intergenic
1097404088 12:59167378-59167400 CTCACTAAACAATGCAAACAGGG - Intergenic
1097450421 12:59731794-59731816 CTCATTACAAAATGCCATGATGG - Intronic
1097562793 12:61229107-61229129 CTCACAACACACTGCAAGAAAGG + Intergenic
1098821722 12:75239413-75239435 CTCAAAGCACAATCCAAGAAAGG - Intergenic
1098890081 12:76001288-76001310 CTCCAAACACAAGGCAGGGAGGG + Intergenic
1100026686 12:90137694-90137716 CTCAATAAACGATGCATAGAAGG - Intergenic
1100318807 12:93470612-93470634 CTCAAAACAGAATGGAGGGATGG - Intronic
1100463290 12:94822006-94822028 CTGAACACACAATTCCAGGAAGG + Intergenic
1104258324 12:127160074-127160096 CCCAATAGATAATCCAAGGAAGG + Intergenic
1106212954 13:27667740-27667762 ATAAATACAGAATGCAAGGCTGG - Intergenic
1106624543 13:31406999-31407021 CAAAACACACAAAGCAAGGAAGG - Intergenic
1110126562 13:71950283-71950305 CTGAAGACACAATGCTAGCAGGG + Intergenic
1110546079 13:76756844-76756866 CTCAGTATACAAAGCAAAGAAGG - Intergenic
1113640462 13:111953542-111953564 CTCAATGCTCAAGGCATGGATGG - Intergenic
1114673696 14:24428133-24428155 CTCCACACTCAATGCAAGGCAGG + Intronic
1115092260 14:29591902-29591924 CTAAAAATACAATGAAAGGAGGG + Intronic
1115361592 14:32509372-32509394 CTCAATAAACAAGCCAAGGTGGG - Intronic
1116766651 14:49080098-49080120 CTCAACACACTAGGCATGGAAGG - Intergenic
1120232646 14:81856636-81856658 CAAAATGCACAAAGCAAGGAAGG + Intergenic
1121267914 14:92616222-92616244 CAAAATGCACAAAGCAAGGAAGG + Intronic
1121584122 14:95051253-95051275 CTGAATAGACAAGGCAGGGAGGG + Intergenic
1125239884 15:37562063-37562085 CTCAACAAACAAGGCATGGAAGG + Intergenic
1125589971 15:40847887-40847909 CTTTCTACAAAATGCAAGGAGGG + Intronic
1128283652 15:66418008-66418030 CAAAATGCACAAAGCAAGGAAGG + Intronic
1128606712 15:69041982-69042004 CTAAATACACGAAGCAGGGATGG - Intronic
1129359413 15:75015242-75015264 CTGAATAAACAAAGGAAGGAGGG - Intronic
1132075733 15:98818335-98818357 CTCAATACACAGTGGAAGTTGGG + Intronic
1133551234 16:6856173-6856195 CTCAATACACATTTGAAGAAGGG - Intronic
1134376575 16:13681223-13681245 CTGACTTGACAATGCAAGGAAGG - Intergenic
1136233115 16:28899239-28899261 CTCTGTACAAAATGAAAGGAGGG - Intronic
1137014775 16:35364013-35364035 CACAAAACACACTGCAGGGAGGG - Intergenic
1137260047 16:46819154-46819176 CGAAACACACAAAGCAAGGAAGG - Intronic
1138255707 16:55557533-55557555 CTAAGTACACAATGGGAGGAAGG + Intronic
1139160640 16:64503836-64503858 CTCAATAAACTATGCAGAGAAGG - Intergenic
1139302683 16:65958886-65958908 CTCAAAAAACAAGGCAAGGCCGG - Intergenic
1140654315 16:77123974-77123996 ATCAATACACAAAGAAGGGAAGG + Intergenic
1140958591 16:79891049-79891071 CTCAATACTCAGCGCAAGAAAGG - Intergenic
1142473983 17:179369-179391 CTGAACCCACAAAGCAAGGAGGG - Intronic
1144284654 17:13762153-13762175 TTCAAGACTCAATGCCAGGACGG + Intergenic
1146314061 17:31793547-31793569 CTGAATACATAATGAAATGATGG + Intergenic
1148631870 17:49117192-49117214 GTCAACACACAATGGAAAGAAGG - Intergenic
1150473915 17:65460073-65460095 CTTATTACACAATGCTAGGGTGG - Intergenic
1150661023 17:67079038-67079060 CTCAGTATATAATACAAGGAAGG - Intronic
1151228859 17:72667411-72667433 AAAAATACACAGTGCAAGGAAGG - Intronic
1155803724 18:30140945-30140967 CCTAATACATAATCCAAGGAAGG + Intergenic
1156078243 18:33306256-33306278 CCCAATAGATAATCCAAGGAAGG - Intronic
1156770838 18:40722258-40722280 CTCATTCCAAGATGCAAGGATGG + Intergenic
1157153799 18:45245052-45245074 CTCATCACACAATGAAATGAAGG + Intronic
1157775964 18:50396579-50396601 CAAAATGCACAAAGCAAGGAAGG - Intergenic
1160607016 18:80059026-80059048 CTCAAGACTCCCTGCAAGGAAGG - Intronic
1162859373 19:13494501-13494523 CAGAATAGACAATGAAAGGAAGG + Intronic
1164040535 19:21488960-21488982 CACAATACACAATGTATGCAGGG - Intronic
1164119924 19:22256891-22256913 CACAATACACAATGTAGGCAGGG + Intergenic
1164127284 19:22329913-22329935 CACAATACACAATGTATGCAGGG - Intergenic
1164181144 19:22819870-22819892 CACAATACACAATGTATGCAGGG - Intergenic
1164281211 19:23770325-23770347 CACAACACACAATGCATGCAGGG - Intronic
1164311777 19:24052210-24052232 CACAACACACAATGCATGCAGGG - Intronic
1164461001 19:28447185-28447207 CCCAATAGATAATCCAAGGAAGG - Intergenic
1164655501 19:29918184-29918206 CAAAACACACAAAGCAAGGAAGG - Intergenic
1164668472 19:30059164-30059186 CTCTATTCACATTGCAATGACGG - Intergenic
925324044 2:3002076-3002098 CTCAAAAGACAATGGAGGGAGGG + Intergenic
925324898 2:3010788-3010810 ATCAATATATAATGCAGGGATGG + Intergenic
926428009 2:12757347-12757369 ATAAATACACAAAGGAAGGAAGG - Intergenic
926483076 2:13423989-13424011 CTCAATAAACTAGGCATGGATGG - Intergenic
926840574 2:17075492-17075514 CTTCATACAAAATGAAAGGATGG - Intergenic
927215211 2:20664680-20664702 CTCAATCCACAATGCACCGAAGG + Intergenic
934852298 2:97709041-97709063 CTCAATAAATATTGCATGGATGG - Intergenic
935091973 2:99904232-99904254 CCCAATACACAATGCAAAACAGG + Intronic
938550684 2:132379357-132379379 CTCAATAGATAATCCAATGAGGG + Intergenic
940148192 2:150570112-150570134 CTCAATACACAATGCAAGGAGGG + Intergenic
940521568 2:154757203-154757225 CCCAAAACACAAAACAAGGATGG - Intronic
941119379 2:161511523-161511545 CTCAATAAACTAGGCAATGAAGG + Intronic
942182322 2:173391685-173391707 CAAAACACACAAAGCAAGGAAGG + Intergenic
942337323 2:174903268-174903290 CTAAATACACAAGGTAATGATGG + Intronic
944199909 2:197095486-197095508 TTCAATATACACTGCAAGAATGG - Intronic
947209613 2:227696410-227696432 CTCAGTACAACATGCAGGGATGG + Intronic
948082066 2:235214593-235214615 CTCAATGCTCCCTGCAAGGAGGG - Intergenic
948479848 2:238242430-238242452 ATCTATACAGAAGGCAAGGAAGG + Intergenic
1168860015 20:1039415-1039437 CTCAAATCACAACGCCAGGAGGG + Intergenic
1169519982 20:6360447-6360469 CTGAATACACACTGCACAGAAGG - Intergenic
1169523059 20:6393786-6393808 CAAAATACACAATGCAAACAAGG - Intergenic
1174432984 20:50484306-50484328 CTAAATACACATGGCGAGGAGGG + Intergenic
1177562110 21:22769638-22769660 GTCAATACACAATGTAGGCAGGG - Intergenic
1184022067 22:41827463-41827485 CAAAATGCACAAAGCAAGGAAGG + Intergenic
949303446 3:2611641-2611663 GCCAATACCCAATGCATGGATGG + Intronic
951336015 3:21422806-21422828 CTCAATAAACCATGTAATGAGGG + Intronic
951579791 3:24150219-24150241 CTCCATACACATTGCAAGTATGG + Intronic
951975045 3:28496871-28496893 CCAAAAACACAATGCAAAGATGG + Intronic
951975059 3:28497162-28497184 CCAAAAACACAATGCAAAGATGG - Intronic
953954757 3:47222945-47222967 TTCTATACACAAGGAAAGGAAGG + Intergenic
955200896 3:56851249-56851271 CTGAATCCACAGTGCTAGGAGGG - Intronic
956260838 3:67339181-67339203 CTCAATTAACAAAGAAAGGAGGG + Intergenic
956814543 3:72896089-72896111 CTCAATTCCTAATGCAATGATGG - Intronic
960828235 3:121815076-121815098 TTCATCACTCAATGCAAGGATGG + Intronic
961374549 3:126455560-126455582 CTCAAAACAAAAAGCCAGGATGG + Intronic
964587861 3:158327472-158327494 CTCGATACATAATGAAATGAAGG - Intronic
965748684 3:171953747-171953769 TTCAATAGACAATGGAACGATGG - Intergenic
965853645 3:173062292-173062314 GTTAAAACACAAGGCAAGGAGGG - Intronic
967009845 3:185422571-185422593 CCCAATACATAATGTTAGGATGG - Intronic
967679928 3:192349772-192349794 CTCAAGACAAAATGCAAGCATGG + Intronic
968386552 4:144230-144252 CAAAATACACAAAGCAAGGAAGG - Intronic
969703188 4:8778941-8778963 CTCACTGTACAATGCAAGGGAGG - Intergenic
974190197 4:58494557-58494579 CCCAATAGATAATCCAAGGAAGG + Intergenic
974572142 4:63666658-63666680 CTCAATATACTAGGCAATGAAGG - Intergenic
977036375 4:91958589-91958611 CTCTATACACAAATCAAGGAAGG - Intergenic
978773990 4:112487313-112487335 CACAATTCAGAATGTAAGGAGGG + Intergenic
979407256 4:120328459-120328481 TTCATTACACAATGTAAGTAAGG - Intergenic
979662798 4:123277648-123277670 CTCAATAAACCAGGCATGGAAGG - Intronic
981786328 4:148483261-148483283 GGCAACAGACAATGCAAGGAAGG - Intergenic
982311272 4:153987818-153987840 CTCACTTTACAATGAAAGGAAGG - Intergenic
982464462 4:155713220-155713242 CCCAATTCACAATGCACTGAGGG + Exonic
982539843 4:156654621-156654643 CTGAATATACTATTCAAGGAGGG + Intergenic
983647133 4:170003420-170003442 CTCAATACACAGATGAAGGAGGG + Intronic
984967587 4:185153755-185153777 CTCAATAGACTAGGCATGGAAGG + Intergenic
986129533 5:4914633-4914655 CTCAAGGCACCATGCTAGGATGG - Intergenic
988104927 5:26732447-26732469 CTCAACACACAAGGCATTGAAGG - Intergenic
988407105 5:30837697-30837719 ATCACTACACAATGCAACAAGGG + Intergenic
988910097 5:35830943-35830965 TTCAAAACAAAATGCAAGTATGG - Intergenic
989069150 5:37492144-37492166 CTCAAAAGACAAAGCTAGGAGGG + Intronic
992066747 5:73116555-73116577 CTAAACACACAAAGCAAGGGAGG - Intergenic
993459870 5:88170187-88170209 CTCAATAAACAAGGCATTGATGG - Intergenic
995147587 5:108804503-108804525 CTCAATAAACTAGGCATGGAAGG - Intronic
995968995 5:117944150-117944172 CTCTATACAGAAGGCAAGGCAGG + Intergenic
996583549 5:125058707-125058729 CTGCATACACGATTCAAGGATGG + Intergenic
996885557 5:128350098-128350120 CTAAATAAAAAATGCAAGGCAGG + Intronic
996975404 5:129427479-129427501 CCCAATAAACAAGGCAAGAAGGG + Intergenic
997192649 5:131952726-131952748 CTAAATACATAATGCAAGAAAGG + Exonic
997292104 5:132744950-132744972 CTGAATACAGAATTCTAGGATGG + Intergenic
998009947 5:138686885-138686907 CTGAAGAGAGAATGCAAGGAAGG - Intronic
998852993 5:146368408-146368430 TTCAAGAAACCATGCAAGGAAGG + Intergenic
1000539176 5:162518920-162518942 ATCAATACACAATTAAAAGAAGG - Intergenic
1002018925 5:176349377-176349399 CTCATTACAAAATGCAAACAGGG + Intronic
1005202418 6:23362212-23362234 CTGAATACATAATGAAATGAAGG - Intergenic
1006706233 6:36023943-36023965 CTCTATCCACATTGCATGGAAGG - Intronic
1007210194 6:40187485-40187507 CTCAAAACTCAATGCAGGGCAGG - Intergenic
1008718155 6:54314886-54314908 CTCCATTCACTATGAAAGGAAGG + Intronic
1009547240 6:65035181-65035203 CTCAACACACTAGGCAATGAAGG + Intronic
1010806022 6:80238059-80238081 CTCAATACTCTTTGGAAGGAAGG - Intronic
1013807441 6:114011221-114011243 CGAAATGCACAAAGCAAGGAGGG + Intronic
1014128745 6:117807146-117807168 CTCAATAAACAAGGTATGGATGG - Intergenic
1017035316 6:150262111-150262133 CTCCTGACACAATGCTAGGATGG + Intergenic
1017839689 6:158211027-158211049 CTCAAAACAAAATGAAAGGCTGG - Intergenic
1018185027 6:161259546-161259568 CTCTATACTCAATGCAGGAAAGG + Intronic
1021742755 7:23704243-23704265 CTCCTAACACAATGCAAGGATGG + Intergenic
1024599157 7:50964359-50964381 CAAAATGCACAAAGCAAGGAGGG - Intergenic
1026257611 7:68726108-68726130 CTCAATATTCACTCCAAGGAGGG + Intergenic
1027621930 7:80498415-80498437 GTCACTACATAAAGCAAGGATGG - Intronic
1028794584 7:94888782-94888804 CTCAGAACACAAAACAAGGAAGG + Intergenic
1031173085 7:118315779-118315801 CTCAATAAACTATGCATTGATGG - Intergenic
1031434913 7:121721730-121721752 CTCAATAAACTAGGCATGGAAGG - Intergenic
1033091452 7:138389904-138389926 CTCAACAAAGAGTGCAAGGAAGG + Intergenic
1035251336 7:157599433-157599455 CTGAATACACAGTGTAAAGATGG + Intronic
1037352838 8:17980479-17980501 CTCAATTTACAATGCTAGGAAGG - Intronic
1038202406 8:25425883-25425905 CTCACTACAATATGCAAGTAGGG + Intergenic
1039797705 8:40929296-40929318 CTCAAAATGCAATCCAAGGAAGG + Intergenic
1041004736 8:53487167-53487189 TTCAATAGACAATGCAATGGTGG + Intergenic
1041828105 8:62121409-62121431 CAAAATGCACAAAGCAAGGAAGG + Intergenic
1041986879 8:63932204-63932226 CGTCATACACAATGCATGGAAGG - Intergenic
1042087363 8:65123395-65123417 CTGGATACATAATGAAAGGAAGG + Intergenic
1043219013 8:77635061-77635083 CTTACTACACAATGCTAGAAAGG + Intergenic
1043921042 8:85983603-85983625 CTCACTGCACAGTGCAGGGAGGG + Intergenic
1044007998 8:86961245-86961267 CCCAATAGACAATCCAATGAAGG + Intronic
1044277032 8:90313173-90313195 GGCTATAAACAATGCAAGGATGG - Intergenic
1047714950 8:127586906-127586928 CTTAATAAACAATGAAAGGATGG + Intergenic
1048584639 8:135763304-135763326 CCCAACACACCATGCAAGCAAGG - Intergenic
1049025353 8:139984549-139984571 CTCAAGACACAAAGCCTGGAAGG + Intronic
1050052000 9:1612262-1612284 CACAATACACAAGGAAAGAAAGG - Intergenic
1053395780 9:37772883-37772905 CTCAATACAGAATTCAAACAAGG - Intronic
1053726716 9:41010008-41010030 CTCAATATATAATGCTAGGCTGG + Intergenic
1056147993 9:83753520-83753542 CCTAATACACAATGCAAGCAAGG + Intronic
1057503429 9:95613892-95613914 TACCACACACAATGCAAGGAAGG - Intergenic
1058157057 9:101527839-101527861 CTGTATACACACAGCAAGGAGGG - Intronic
1060133680 9:121130872-121130894 CTGGATACACAATGAAATGAAGG - Intronic
1060812233 9:126616268-126616290 CTCAATACACACTACCAGAAAGG - Intronic
1061370781 9:130196186-130196208 CCCACTGCACAATGCCAGGAGGG - Intronic
1061617705 9:131791252-131791274 CTGAATACACGAAGCCAGGAGGG + Intergenic
1186895512 X:14000883-14000905 CTCAAAACAAAATAAAAGGACGG - Intergenic
1187536144 X:20143029-20143051 TTCAATACACACAGAAAGGAAGG + Intergenic
1187749880 X:22450641-22450663 CTCAACAAACTATGCAAAGAAGG + Intergenic
1192984906 X:76387254-76387276 CAAAACACACAAAGCAAGGAAGG + Intergenic
1193058071 X:77175735-77175757 CTCAATATACTATAGAAGGAGGG + Intergenic
1193066185 X:77263121-77263143 CTGAATACAGAATTCAAGGTTGG - Intergenic
1199523091 X:148759608-148759630 CTGAATGCACAGTGCAAGCATGG + Intronic